circad | circRNAs associated with diseases

hsa_circRNA_ 404457
Gene	TCEA3	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Diabetic Retinopathy	ICD-10	Diabetic retinopathy (H36.0*)
DBLink	Link to database	PMID	28817829
Experimental Method
Sample Type	Serum sample	Comparison	Fifty-five individuals, consisting of 19 T2DR patients (T2DM patients with proliferative DR), 15 T2DM patients without DR (T2DM), and 21 age-matched control subjects (controls)
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AAGACCATCGGTGGAAAGGA Reverse CGGACCCCATTAACAGCAACT	Statistics	Fold Change : Upregulated,2.316,2.080 pvalue : p=0.006,0.001
Citation
Gu, Y, Ke, G, Wang, L, Zhou, E, Zhu, K, Wei, Y (2017). Altered Expression Profile of Circular RNAs in the Serum of Patients with Diabetic Retinopathy Revealed by Microarray. Ophthalmic Res., 58, 3:176-184.