Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_ 404457 | |||
Gene | TCEA3 | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Diabetic Retinopathy | ICD-10 | Diabetic retinopathy (H36.0*) |
DBLink | Link to database | PMID | 28817829 |
Experimental Method | |||
Sample Type | Serum sample | Comparison | Fifty-five individuals, consisting of 19 T2DR patients (T2DM patients with proliferative DR), 15 T2DM patients without DR (T2DM), and 21 age-matched control subjects (controls) |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward AAGACCATCGGTGGAAAGGA ReverseCGGACCCCATTAACAGCAACT | Statistics | Fold Change : Upregulated,2.316,2.080 pvalue : p=0.006,0.001 |
Citation | |||
Gu, Y, Ke, G, Wang, L, Zhou, E, Zhu, K, Wei, Y (2017). Altered Expression Profile of Circular RNAs in the Serum of Patients with Diabetic Retinopathy Revealed by Microarray. Ophthalmic Res., 58, 3:176-184. |